Neuropsychiatric Genetics Unit, Department of Psychological Medicine, University of Wales College of Medicine, Cardiff
Department of Medical Genetics, Medical University Sofia, Bulgaria
Plovdiv Psychiatric Dispensary, Plovdiv, Bulgaria
Clinic of Child Psychiatry, Sofia, Bulgaria
Department of Psychiatry, Royal College of Surgeons in Ireland, Beaumont Hospital, Dublin, Ireland
Department of Medical Genetics, Medical University Sofia, Bulgaria
Neuropsychiatric Genetics Unit, Department of Psychological Medicine, University of Wales College of Medicine, Cardiff, UK
Correspondence: Professor Michael J.Owen, Neuropsychiatric Genetics Unit, Department of Psychological Medicine, University of Wales College of Medicine, Cardiff CF14 4XN, UK. Tel: +44 (0)2920 74 3058; fax: +44 (0)2920 74 6554; e-mail: owenmj{at}cardiff.ac.uk
Declaration of interest Funding from the PPP Healthcare Medical Trust, London, UK. Collection of probands in Bulgaria funded by the Janssen Research Foundation and in the UK by the Medical Research Council.
|
|
|---|
Aims To test the hypothesis that there is an increased rate of VCFS among patients with early-onset psychosis (age at onset <18 years). We screened 192 early-onset patients and 329 patients with adult-onset schizophrenia.
Method We genotyped the patients and 444 healthy controls for hemizygosity of five microsatellite markers and one single nucleotide polymorphism that map to the 22q11-deleted region.
Results One patient had a VCFS deletion, confirmed with semi-quantitative polymerase chain reaction. None of the controls showed a pattern of genotypes consistent with hemizygosity.
Conclusions VCFS may be less frequent among patients with psychosis than previously suggested; this rate is not increased among early-onset patients.
|
|
|---|
![]() View larger version (20K): [in a new window] [as a PowerPoint slide] |
Fig. 1 Distribution of the genotyped markers (in blocks) in the velo-cardio-facial
syndrome (VCFS) region on chromosome 22q11.2. LCR, low copy repeat.
|
Background
Several studies of individuals with VCFS have reported an increased
incidence of psychosis, particularly schizophrenia
(Shprintzen et al,
1992; Karayiorgou et
al, 1995; Papolos et
al, 1996; Gothelf et
al, 1997; Bassett et
al, 1998; Murphy et
al, 1999; Usiskin et
al, 1999). The rate of VCFS in patients with schizophrenia is
reported to be 0.332% (Chow et
al, 1997; Karayiorgou
et al, 1997; Arinami
et al, 2001), compared with the frequency in the general
population of only
0.025% (Wilson
et al, 1994). When individuals with schizophrenia have
been selected for the presence of two or more clinical features consistent
with VCFS (palatal, cardiac, facial or other congenital anomalies, and/or
learning difficulties), 22q11 deletions have been identified in 2059%
of cases (Gothelf et al,
1997; Bassett et al,
1998).
Recently, it has been suggested that VCFS might be especially common in individuals with psychosis of early onset. Papolos et al (1996) reported that bipolar illness associated with VCFS usually has a childhood onset, whereas Usiskin et al (1999) reported that 3/47 (6.4%) patients with a very-early-onset diagnosis of schizophrenia (<13 years) had VCFS deletions.
Aim
To test the hypothesis that there is an increased rate of VCFS among
patients with early-onset psychosis, we screened 192 patients whose first
psychotic episode had occurred before their 18th birthday (referred to as
juvenile-onset cases) for 22q11 deletions. We postulated that more than 1% of
patients would have such deletions. We also screened 329 patients with
schizophrenia whose age at onset had been after their 18th birthday, to
estimate the frequency of VCFS deletions in a more typical sample of
cases.
|
|
|---|
|
View this table: [in a new window] | Table 1 Age distribution of the juvenile-onset cases of psychosis |
The remaining subjects were 329 unrelated UK patients with schizophrenia who did not satisfy our criteria for juvenile onset, either because their age at onset was clearly more than 18 years or because there was insufficient information available to define onset precisely. Of these, 244 were male and 85 were female. Subjects with an IQ <70 were excluded. In Bulgaria, patients were recruited by their own psychiatrists from both in- and out-patient settings in the capital Sofia and two major towns and their surrounding districts in the south and south-west of the country. In the UK, patients were recruited via psychiatrists from in-patient and out-patient services from a number of centres in Wales and England.
All patients were interviewed with an abbreviated version of the Schedules for Clinical Assessment in Neuropsychiatry (SCAN; Wing et al, 1990) and a best-estimate consensus diagnosis was reached on the basis of the interview and psychiatric hospital notes by two experienced researchers. The DSMIV (American Psychiatric Association, 1994) diagnostic criteria were used in the study. The teams in Bulgaria and the UK used the same clinical instruments. The consensus diagnoses in Bulgaria were made in each case by G.K. and I.N. The UK sample was collected over a period of several years by a number of different fieldworkers. A consensus diagnosis had to be reached by two of them for a patient to be included in the study. All patients were interviewed when they were adults.
We also genotyped a sample of 444 healthy blood donors who had been broadly matched for gender and age with the patients from the general and juvenile samples from the UK population. The blood donors were recruited from the UK blood transfusion service in Cardiff, Wales. All patients and controls signed an informed consent form for participation in genetic association studies.
Genotyping
We screened for the presence of deletions by genotyping five microsatellite
markers and one single nucleotide polymorphism in the deleted VCFS region
(Fig. 1). Individuals who have
a deletion are expected to have only one allele for each of these markers
because they have only one copy of the chromosome 22 for this region. The
chances of an individual having only one allele of any one marker but having
two copies of that marker (i.e. being homozygous for that marker) depend on
the allele frequencies and number of alleles of the marker. The heterozygosity
(the frequency of observing individuals with two different alleles) of the
markers that we chose ranged from
30% for PCQAP to 89% for D22S264. The
probability that an individual is homozygous for each of the six markers in
the absence of deletions is low (
0.1%), therefore we expected that this
method would allow us to end up with only a small number of individuals who
were potential candidates to have deletions. We intended to confirm the
presence of a deletion by fluorescence in situ hybridisation (FISH)
if we had available cell lines from that individual, or by semi-quantitative
polymerase chain reaction (PCR; see below). Our screening method is much more
cost-effective compared with performing FISH on all the samples.
For the juvenile cases we used three known microsatellite markers (D22S264,
D22S941, D22S944), one CA repeat that we identified from the genomic sequence
of the clone AC000068.2 (indicated as AC0068.2 in
Fig. 1) and one CAG repeat
within the gene PCQAP (described by De Luca
et al, 2003). This ensured that even some of the smaller,
less common deletions were covered with a sufficient number of polymorphic
markers. All five markers are in the typically deleted region (3 Mb) and, with
the exception of PCQAP, are also within the less common region (1.5 Mb)
deleted in 8% of the patients with VCFS
(Fig. 1). The single nucleotide
polymorphism that we used is a well-known marker within the
catechol-O-methyltransferase (COMT) gene (Val158Met) that has been
reported in numerous studies in the past (e.g.
Kirov et al, 1998). It has a heterozygosity of
50% because the two alleles have an almost
equal frequency in the UK population.
For the patients with schizophrenia having an age at onset of more than 18 years we used five microsatellite markers (D22S1638, D22S941, D22S944, D22S264, D22S311) and the Val158Met single nucleotide polymorphism at COMT. All the microsatellites are within the common (3 Mb) deleted region.
The microsatellites were amplified using standard PCRs with forward primers 5'-labelled with fluorescent dyes (FAM, HEX or TET). The fragments were loaded together and resolved on an AB1373 automated sequencer.
Confirmation of VCFS deletion
To confirm the presence of VCFS deletion we used semi-quantitative PCR. For
this assay we simultaneously amplified two fragments in the same reaction. One
fragment was chosen within exon 5 of COMT (which should be deleted in VCFS
cases) and the other fragment was chosen from exon 11 of the ABCG1 gene on
chromosome 21. Both genes have been screened extensively in the past for
genetic variants: the ABCG1 gene by us
(Kirov et al, 2001)
and the COMT gene by a number of teams. This ensured that there would be no
common polymorphisms within these fragments that can interfere with the
reaction. Primer sequences for the COMT fragment were:
forward: CTGTTCCAGGTCACCCTTGT reverse: CAGGTACCGGTCCTTCCAGT
For ABCG1 we used the following primers:
forward: TCATTGGCCTGCTGTACTTG reverse: CAGCGGTCTGTCACTCACAT
The forward primer of each pair was 5'-labelled with a fluorescent
dye (FAM). The fragment from COMT amplified a product 120 bp in size, whereas
the ABCG1 amplified a product of 141 bp. All four primers were added to the
same PCR reaction, thus ensuring identical conditions for the amplification of
both fragments. We optimised the reaction by reducing the number of cycles so
that it was terminated during the exponential phase of the PCR, during which
the amount of PCR product is dependent upon the starting number of DNA
template molecules. The PCR products were quantitated on an ABI373 automated
sequencer. If a person has a single copy of COMT, then the ratio of the
amounts of the PCR products representing COMT and ABCG1 is
50% that of
the ratio obtained from an individual with two copies of COMT
(Fig. 2).
![]() View larger version (8K): [in a new window] [as a PowerPoint slide] |
Fig. 2 Overlaid images of the products of the COMT (left) and ABCG1 (right)
fragments of three individuals. The lower two traces (almost identical) of the
COMT fragment are from one known velo-cardio-facial syndrome (VCFS) case and
the patient with schizophrenia that we tested. The size of the peaks is
50% smaller than the peak of the control (top trace).
|
|
|
|---|
In the test sample, only one individual (a patient with schizophrenia) gave a pattern of homozygosity for all markers tested. This effectively excludes the presence of deletions in the rest of the population. The homozygous individual had been genotyped also for a number of single nucleotide polymorphisms in three genes from the VCFS region as part of our ongoing genetic research projects. We observed that he was homozygous for every single nucleotide polymorphism genotyped in the COMT, ARVCF and TBX1 genes (a total of 20 single nucleotide polymorphisms), thus adding further evidence that he had a VCFS deletion. We did not have a cell line for this individual and were unable to confirm the deletion by FISH. We therefore performed the semi-quantitative PCR described above. To provide positive and negative controls for the assay, we also genotyped known individuals with VCFS and those without VCFS, respectively. The overlaid traces of one control, one known VCFS case and the suspected VCFS case are shown in Fig. 2. This experiment confirmed that the individual had a VCFS deletion because his trace was similar to that of the known VCFS case and about half the size of the COMT fragment of the non-deleted case.
|
|
|---|
The patient with VCFS deletion that we identified did not have a recognised low IQ but had left school with no qualifications. He did not have children. According to his own account, he developed signs of illness at around the age of 17 years, when he thought that his father was the Devil (there was no hospital documentation to support this, so he did not satisfy our strict criteria for inclusion in the juvenile psychosis sample). His first hospitalisation was at the age of 21 years. Over the years he had exhibited auditory and olfactory hallucinations, thought withdrawal, bizarre delusions, paranoid ideas and suicidal ideation.
Statistical consideration
If the frequency of 22q11 deletions was 2% in juvenile-onset samples
ascertained according to our criteria then we would have had 98% power to
detect at least one observation of a deletion. If the true rate is 1%, the
corresponding power was 85%. Our data suggest that if people with psychosis,
including juvenile-onset cases, have an increased risk of 22q11 deletions it
is only a modest increase. On combining our data with the three previous
studies that estimated the frequency of VCFS in subjects ascertained for
schizophrenia without major bias towards co-ascertaining subjects with VCFS,
there are seven observations of 22q11 deletions out of 1077 individuals with
schizophrenia, which is a prevalence of
0.65% (we exclude individuals
with bipolar disorder in our sample from the overall figure).
If the prevalence of VCFS is 1:4000 in the general population and 24% of these people develop schizophrenia (Murphy et al, 1999), then 1:16 666 of the general population should have both schizophrenia and VCFS. Assuming that the prevalence of schizophrenia is 1% in the general population, we would expect that 1:166 or 0.6% of randomly ascertained subjects with schizophrenia would have VCFS. The frequently quoted figure of 1/4000 for VCFS in the general population is only an approximation based on the rate of congenital heart defects (Wilson et al, 1994). The only other large study (du Montcel et al, 1996) reported a frequency of 1:9700 based on symptomatic cases from a Birth Defects Registry in France. Both studies stressed that the rate of milder cases is likely to be higher but the precise incidence is not known, therefore our estimate that an unselected sample of 0.6% of patients with schizophrenia should also have VCFS can be only an approximation. However, it concurs well with the figure of 0.65% that represents the combined world literature. Further large-scale screens are required on samples ascertained using epidemiological principles to obtain a precise estimate of the risk for this deletion in typical schizophrenia.
Age at onset and IQ
One possible characteristic of our sample that may have reduced the
prevalence of deletions is that individuals with an IQ of <70 were
excluded. In the study of Arinami et al
(2001), the patient with
schizophrenia and VCFS deletion had an IQ of 61. In the study of Karayiorgou
et al (1997), two
patients with schizophrenia had a history of learning problems as children.
One of the two patients found by Chow et al
(1997) also had mental
retardation. Thus, a stricter interpretation of our data is that a VCFS
deletion is an uncommon cause for schizophrenia in patients with a normal IQ.
It is also important to note that all three individuals with childhood-onset
schizophrenia who were found to have VCFS in the study of Usiskin et
al (1999) developed signs
of psychosis before their 13th birthday. Only eight of our patients had an
onset this young (Table 1). It
is therefore possible that the prevalence of 22q11 deletions is higher in
cases with very early onset, although further work is needed in this unusual
group of cases. The patient that we identified with VCFS had an illness onset
at the age of 17 years, but, even if we were to classify this patient as
having a juvenile-onset psychosis, the rate of VCFS among this population is
still lower than previously proposed.
Possible sources of bias
It is not known whether publication bias has influenced the previous
estimates of VCFS rates in patients with schizophrenia but it is more likely,
in principle, that a small study that detected at least one case of VCFS will
be published than a small study that did not. This bias will act to inflate
the reported prevalence of VCFS in the population with schizophrenia. On the
other hand, our genetic study might be biased against finding VCFS cases
because we did not include patients with known low IQ, as discussed above.
Another factor that will reduce the observed prevalence of VCFS is the
increased mortality in these patients, due largely to congenital heart
disease. This would have been even greater 30 or 40 years ago, when many
potential current individuals with VCFS would have been born, so that they
would be less likely to reach the average age of ascertainment.
Criteria for screening for VCFS
Our data indicate that screening for VCFS is not justified in the general
population of patients with psychosis, even in those with an early onset, at
least when the first episode of psychosis occurs after the age of 13 years.
The main criteria for screening in psychosis remain the presence of cleft lip
and/or palate, characteristic dysmorphology, learning disability, congenital
heart disease or hypocalcaemia (Murphy
& Owen, 1996; Gothelf
et al, 1997; Bassett
et al, 1998).
|
|
|---|
LIMITATIONS
|
|
|---|
Related articles in BJP:
This article has been cited by other articles:
![]() |
G. Kirov, D. Grozeva, N. Norton, D. Ivanov, K. K. Mantripragada, P. Holmans, International Schizophrenia Consortium, the Wellcome Trust Case Control Consortium, N. Craddock, M. J. Owen, et al. Support for the involvement of large copy number variants in the pathogenesis of schizophrenia Hum. Mol. Genet., April 15, 2009; 18(8): 1497 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Lauterbach, A. L. Stanislawski-Zygaj, and S. Benjamin The Differential Diagnosis of Childhood- and Young Adult-Onset Disorders That Include Psychosis J Neuropsychiatry Clin Neurosci, November 1, 2008; 20(4): 409 - 418. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Williams, H. Williams, E. Majounie, N. Norton, B. Glaser, H. R. Morris, M. J. Owen, and M. C. O'Donovan Analysis of copy number variation using quantitative interspecies competitive PCR Nucleic Acids Res., October 1, 2008; 36(17): e112 - e112. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Williams, B. Glaser, N. Norton, H. Williams, T. Pierce, V. Moskvina, S. Monks, J. Del Favero, D. Goossens, D. Rujescu, et al. Strong evidence that GNB1L is associated with schizophrenia Hum. Mol. Genet., February 14, 2008; 17(4): 555 - 566. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Keen-Kim and N. B. Freimer Genetics and Epidemiology of Tourette Syndrome J Child Neurol, August 1, 2006; 21(8): 665 - 671. [Abstract] [PDF] |
||||
![]() |
N Craddock, M C O'Donovan, and M J Owen The genetics of schizophrenia and bipolar disorder: dissecting psychosis J. Med. Genet., March 1, 2005; 42(3): 193 - 204. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||